123 Comments
User's avatar
Factscinator's avatar

In recognition of Proton Magic's relentless pursuit to unveil the fraud of viro Lie gy, I have composed a few lines of verse in his honor:

Ode to Hawkish for Truth

Amid dawn’s first light, the hawk leaves his nest,

Roaming the skies, for the Germ Theory pest.

He can’t return empty-taloned, young minds to feed,

Bad news for Sagehana, it was his time to bleed.

From crooked CDC peaks, to the murky UKHSA *valley below,

He circles the shadows, where hidden lies grow.

Circling on high, all their deceptions he sees,

His lightning dives, catching prey with ease.

“Virology’s” lies stalk with, a sly, dark grin,

Until the hawk stoops, and his talons rip in.

The hunt for truth, Proton never flees,

His powerful talons bring, viro Lie gy to its knees.

The target caught, the hawk grips its prey,

Home flight to Substack, he's soaring our way.

In that nest high above, young hungry minds wait,

Eager for knowledge, to satiate.

Answers from research flesh, his beak carefully tears,

Feeding hungry minds, with the truth it bears.

Each shred of flesh, a revelation untold,

Nourishing our minds, with wisdom of gold.

For in the nest of science, hungry children yearn,

To learn, to grow, to question and discern.

With each morsel devoured, we’re filled with delight,

Feasting on truths revealed, from the hawk’s research flight.

So, let us honour, sing his praise,

This noble hawk, whose steady gaze,

Protects the light, as the flying sleuth,

Beware, deceivers, proton's hawkish for truth.

* Feel free to substitute valley with swamp depending on how you regard the UKHSA, formerly Public Hellth England. Shithole works, too 😀😀

Expand full comment
Proton Magic's avatar

You are just amazing and deep thanks!

Expand full comment
Factscinator's avatar

Pleasure guv‘na!! Love your work!!

Expand full comment
Amaterasu Solar's avatar

Utterly brilliant! The virus proponents duck and dodge but never come straight forward. If They did, it would be oh so clear that They are empty-handed. So glad to have the opportunity to witness the fun You're having!!!

Expand full comment
DrLatusDextro's avatar

It appears fascinating and transfixing nonsense, spruiked by a pendulum swinging hypnotist with an awful lot to conceal and very much to gain. But I tell you PM, it ain't half as much fun and an awful lot simpler to repair to the original "descriptions" or should one say, "annunciations" of 'influenza' or 'corona' or 'canine parvovirus', for example. The desperation appears palpable as the experimental methodological meanderings lead to a defeat of even the most wishful thinking, those who A PRIORI believed in the phantasmagorical delusion of a 'self-replicating intracellular parasite' but could simply not surmount the delusion. In the end it became almost a dull-witted grand unification theory of everything pathological. Medicine and therapeutics appears replete with examples of this bizarre, commercially confounded behaviour. Snake oil salesman, BigPharma and BigMedicine grifters now occupy the same space in spades, inhabiting in silico models with delight. Politicians and corporations find that eminently useful.

Expand full comment
Michael Wallach's avatar

i love this. especially bozo! but do me a favor - translate this craziness into english please? its the key paragraph of the fan wu paper:

The viral genome organization of WHCV was determined by sequence alignment to two representative members of the genus Betacoronavirus: a coronavirus associated with humans (SARS-CoV Tor2, GenBank accession number AY274119) and a coronavirus associated with bats (bat SL-CoVZC45, GenBank accession number MG772933). The un-translational regions and open-reading frame (ORF) of WHCV were mapped on the basis of this sequence alignment and ORF prediction. The WHCV viral genome was similar to these two coronaviruses (Fig. ​(Fig.11 and Supplementary Table 3). The order of genes (5â€Č to 3â€Č) was as follows: replicase ORF1ab, spike (S), envelope (E), membrane (M) and nucleocapsid (N). WHCV has 5â€Č and 3â€Č terminal sequences that are typical of betacoronaviruses, with 265 nt at the 5â€Č terminal end and 229 nt at the 3â€Č terminal end. The predicted replicase ORF1ab gene of WHCV is 21,291 nt in length and contained 16 predicted non-structural proteins (Supplementary Table 4), followed by (at least) 13 downstream ORFs. Additionally, WHCV shares a highly conserved domain (LLRKNGNKG: amino acids 122–130) in nsp1 with SARS-CoV. The predicted S, ORF3a, E, M and N genes of WHCV are 3,822, 828, 228, 669 and 1,260 nt in length, respectively. In addition to these ORF regions, which are shared by all members of the subgenus Sarbecovirus, WHCV is similar to SARS-CoV in that it carries a predicted ORF8 gene (with a length of 366 nt) that is located between the M and N ORF genes. The functions of WHCV ORFs were predicted on the basis of those of known coronaviruses and are described in Supplementary Table 5. In a manner similar to SARS-CoV Tor2, a leader transcription regulatory sequence (TRS) and nine putative body TRSs could be readily identified upstream of the 5â€Č end of the ORF in WHCV, and the putative conserved TRS core sequence appeared in two forms—ACGAAC or CUAAAC (Supplementary Table 6).

Expand full comment
Proton Magic's avatar

Hi Mike thanks for writing. This all just means there is a made-up library of alphabets. It's seems real because of all the big words like ORF and 5' and all the letters, none of the prior corona viruses have ever been found.

Change the word "genome" to "string of letters", 'cause there is no viral genome made from a biologic object called virus. You can get a degree of homology score based on seq overlaps. What does that mean besides computers are good at what they do.

But remember as I opined on your ss the other day, they just looked at the library, found the seqs they need to make it look like a bioweapon and a virus, stitch those together into a report they like, reverse engineer a fakery to say what the primers found and TELL you it was a based on pcr primers of a mixed patient sample. It's like you make a movie and edit it to make sense, it's human fabrication for a purpose, but you can say a computer did it-maybe AI can do it but that is just like telling AI to make what you need anyway. The primers are decided AFTER you decided what fake genome you want, not before.

Say you take 1,000 lego parts and make a space ship using 100 parts. So you can use 10 parts of the 100 and say they relate to the space ship. Sure, you took them from the ship, so no sh*t! That's how Illumina prints out what you want from the 10 blocks, because IT ALREADY KNOWS what you want to make because you programmed it to make it. Each time you take the 10 pieces and align them with some a similar space ship 9 or 10 of them will always align because you made all the ships nearly the same way on purpose, voilĂ  you have 99% homology because you have the same ace of spades stuffed up your sleeve you can find the ace of spades each time.

The official Illumina blurb just omits the made-up parts so it seems like it is doing something:

The Illumina read sequencing, ”is a software (app) alignment against a “reference genome”: https://www.illumina.com/science/technology/next-generation-sequencing/beginners/advantages/ngs-vs-sanger.html

Some high-up no-virus people agreed with me when I proposed this but they, and to some degree I, thought it is better to debunk what the papers say for the credibility of argument, not the credibility of what makes sense based on the purpose of this project which is to fake a virus and pandemic. Nothing can be left to chance and all the fake genome pieces need to have the fake bioweapon pieces in it, HIV, Furin Cleavage, etc., and it all has to fit in place beforehand, in LOCKSTEP.

Expand full comment
Javier Lopez's avatar

"Some high-up no-virus people agreed with me but thought it is better to debunk what the paper says for the credibility of argument, not the credibility of what makes sense based on what is the purpose of all this."

My head is spinning. Can you unravel that second part so even someone like me can understand what you mean exactly?

Expand full comment
Proton Magic's avatar

Sure, the argument is based on the paper because that is good enough to say there was no virus, but the purpose of all this means it is a project, nothing can be left to chance and all the fake genome pieces need to have the fake bioweapon pieces in it, HIV, Furin Cleavage, etc. I will adjust the comment to clear that up thanks!

Expand full comment
Javier Lopez's avatar

Thanks! That adds a whole lot more info to chew on!

Would I be on the right track in saying that there are many more layers to the con than at first visible.

Would it also be correct to say that most people involved in the overall conjob of virology and vaccine development are actually blissfully unaware of the con and think they are saving the world by following the protocols they've been indoctrinated with their entire careers.

If so, the masters of the con may or may not also include the propagandists popping up on alternative media to push the lab leak, furin cleavage site, chimeric bioweapon, gain of function, jibber jabber so that everyone following alt media parrots all of the above as if 100% truth because it came from the mouth of a "trusted" expert - one of our own. I'm thinking of the chap that popped up on Infowars very early on to "educate" us all about it. Name slips me right now. Boyle I think his name was. Yep... Francis Boyle https://en.wikipedia.org/wiki/Francis_Boyle

So many layers. So many deceivers and deceived.

And yet so simple if we just go back to the start and realize that no virus has been shown to exist therefore everything that follows - computer programs and models is bunk.

Expand full comment
Proton Magic's avatar

There is probably a montage of many truthers, cons, and fakes of each. Info Wars is a fake alt media because of so much mind bending, but does give out some good info as long as you are aware of them. Boyle was in the same program at Kissinger and Schwab, soon after Schwab, he is in their camp through and through.

Expand full comment
Javier Lopez's avatar

Oh, that explains everything! Thanks for all the work you do Proton. Much appreciated.

Expand full comment
Chris's avatar

Thank you. I still struggle to understand, even with your explanations. But I no longer accept the "scientific" narrative about "viruses."

Expand full comment
Rick's avatar

Another great explanation of conventional mumbo jumbo.

As the Emporer rides again and all the sheeple oooh and ahhh about how beautiful he is

We once again shout out:

He's Naked!

Expand full comment
Ray Horvath, "The Source" :)'s avatar

Proton, you are one of the handful authors with whom, I feel, I am sharing the same boat, and you are my favorite for several reasons.

Your patience to read nonsense and refute minute details is amazing, as always! Normally, I am happy with my conclusion about viruses, which I published about two years ago, and it matches the contents of your article:

https://rayhorvaththesource.substack.com/p/what-is-a-virus

However, as opposed to me, you are providing spectacular pieces of observation.

Your method also reminds me of my article from 2022 in which I made attempts to offer examples of processing information from unreliable resources (well, nobody, including me, is totally reliable):

https://rayhorvaththesource.substack.com/p/what-to-read-now-and-how

My wow factor nearly culminated, when I realized that you even have the patience to read "Sage"! "Moe" happens to be a valuable commenter on my stack, too, so after two years of staying away from Sage, I might want to give it another try. :)

Still, Dr. Pain is certainly what the name says in the underparts. Sadly, his comments are also amazingly primitive, showing the "Ph. D." (I have two, but I am not using the title even on Substack) means nothing. It seems that your comments to him would have had a better chance to receive a decent answer from the trained monkey on the bicycle in your picture demonstrating the significance of "cycling."

When I was a child, my younger sister and I used to feel sorry for the clowns in the circus, because (s)he HAD TO make people laugh. In this case, you effortlessly demonstrate that circus is part of the convid theater that started the Great Plandemic of 2020.

As you said it in one of your recent articles, the focus must not be missed, but I also happened to write an article today about the much-publicized refutation of Virology:

https://rayhorvaththesource.substack.com/p/what-can-defeating-virology-accomplish

Expand full comment
Virginia Stoner's avatar

Proving virology is a lie can accomplish at least one thing for sure: it can prove that the 529k additional deaths in the US in 2020 were not caused by a virus.

Expand full comment
Ray Horvath, "The Source" :)'s avatar

People couldn't do a darn thing, anyway. Think about the chemtrails

https://rayhorvaththesource.substack.com/p/i-fell-and-i-cant-get-up-is-this

or Maui... The 72 "mandatory" childhood "vaccines" are also there, along with the K "vitamin" for newborns...

Expand full comment
Virginia Stoner's avatar

The People are powerless, eh? It is not an authoritarian gov't forcibly vaccinating children to 'protect them from viruses'--it is parents making a voluntary choice to subject their children to vaccination--because they believe viruses exist and cause disease.

Expand full comment
Ray Horvath, "The Source" :)'s avatar

No peasant or slave uprising has ever succeeded. Yes, people are powerless; they've always been. The "do not comply" stuff just doesn't work:

https://rayhorvaththesource.substack.com/p/do-not-comply-no-kidding

In many places in the US, children are taken away from parents who refuse the injections. A couple in NYC lost their newborn for several months after they turned down the K "vitamin" injection, and they were lucky to get the child back at all; heavily poisoned with "vaccines" and emotionally injured...

Expand full comment
Virginia Stoner's avatar

And at birth, parents have to be sure not to inadvertently consent to vaccination when they sign their admission paperwork (it's in there). And, from what I hear, they need to keep their infant within their eyesight at all times while n the hospital, to protect him from nonconsensual vaccination with the HepB or Vit K. If it were me I would also casually mention, in a conversational way, that if anyone were to vaccinate your newborn without your consent, you would make a complaint of criminal assault to the county prosecutor, as well as filing a civil suit against everyone involved.

Expand full comment
Virginia Stoner's avatar

So I guess your purpose is to spread the message of can't win, don't try. Duly noted.

In most states, all parents have to do is file an exemption for school vaccines. They shouldn't have to, but that is the procedure. If they don't that is on them, not an authoritarian state. Does sh*t happen? No doubt. Could stories like the one you told be fabricated to intimidate parents? Of course. Who knows these days.

Expand full comment
Ray Horvath, "The Source" :)'s avatar

Nope, that's not the message, but you obviously haven't read any of my articles, including this one, so why are you putting words into my mouth?

Parents must be informed about the "laws" in their states, so I am posting that, whether you like it or not. A "state of national emergency" can actually mandate ALL "vaccines" for everybody, unless they want to end up in a death camp:

https://rayhorvaththesource.substack.com/p/walmarts-are-prepared-for-becoming

"Vaccination" is moot, anyway. There are various other legit forms to "vaccinate" people. This was two years ago (but since then, things have evolved):

https://rayhorvaththesource.substack.com/p/no-need-for-any-more-vaccinations

Please, stop posting comments until you read at least the article after which you are posting. Otherwise, you only spread confusion and provide disruption, which I won't be able to allow.

Last warning.

Expand full comment
Virginia Stoner's avatar

You are basically saying, if a democide occurred in 2020 by means unknown, we should pay no attention, because we are powerless to change it. Yikes. I hope you are not right--and I am going to act as if you are not, with the dream that if a covert mass-murder were widely exposed, the People just might object--a lot.

Expand full comment
Ray Horvath, "The Source" :)'s avatar

I am not saying anything. Facts speak for themselves.

Expand full comment
Virginia Stoner's avatar

Or, in the immortal words of Homer Simpson, "Can't win, don't try."

Expand full comment
Ray Horvath, "The Source" :)'s avatar

I do what I can. I'm sure, everyone will do the same. Knowing one's limits, however, might make the objectives more realistic...

Expand full comment
GeoffPainPhD's avatar

Hello Ray, you subscrbed to my Substack in January 2024 and have only opened 2 of 383 email notifications I sent you. You have never clicked on any links within my articles.

Please feel free to unsubscribe.

Expand full comment
C.J. Huxley's avatar

Good explanation proton. I've come to similar conclusions which I address in my book. These experiments don't "isolate" a virus by any common sense definition. Rather, they erroneously claim RNA that was sequenced must be from a virus (when it could be anything from the patient as you pointed out).

It's like saying you found proof of Bigfoot because you sequenced RNA from some brown hair you found in the woods.

https://www.amazon.com/What-COVID-Vaccines-Really-Hypothesis/dp/B0CYZTT8T7/

Expand full comment
henjin's avatar

If the raw reads in the Fan Wu paper didn't come from SARS-CoV-2 but "from the patient" or "any other organisms living in the patient", then which organisms are those?

For example in the read pair with the ID 11566903, both reads have a perfect match of 151 out of 151 bases to the Wuhan-Hu-1 reference genome. You can try to go here: https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&page_size=10&acc=SRR10971381&display=reads.

Enter the read ID to the search field. Then copy either of the two reads. Then copy the first read: "AGCAGGTTTCTTATAACCAGTTAACTGGTTTAAATCATCAGCAAATTTGATATTATCACATACAAACTTAAAATTATCGAAGCTTGCGTTTGGATATGGTTGGTTTGGTACAAGATCAATTGGTTGCTCTGTGAAATAAGAATTGTCTTTC". Then paste the read to the search field here, and enter "Viruses (taxid:10239)" to the organism field and click the "exclude" checkbox next to it: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome. Then when you click the "BLAST" button, the only results are synthetic clones and cloning vectors of SARS-CoV-2, because they are not classified under viruses, and no other sequences in the BLAST database matched the read. So if the read comes from some other organism, is it an organism that is missing from the BLAST database?

---

You wrote: "'Illumina read sequencing' is a software (app) alignment against a 'reference genome'." However sequencing is done by hardware, and alignment is a software procedure that comes after sequencing. The raw reads produced by an Illumina sequencer can also be used to do de-novo assembly which doesn't require using a reference genome, like how Fan Wu et al. assembled the genome of SARS-CoV-2 using MEGAHIT.

Expand full comment
Proton Magic's avatar

excellent q Henjin❣

Instead of BLAST use IMDB robust title search here: https://www.imdb.com/search/title/

Put in "Corona Zombies", does this answer your question?

Expand full comment
Charlie's avatar

Proof positive a black bear virus exists!

I walk my trail and the black bear virus is present. I see the tracks in the mud. Oh my gosh golly the black bear virus will get me!

Rarely if do I see her. But today my fate is sealed. I got between mama virus and two small black bear viruses and big virus killed me protecting the small and growing viruses. Because I’m dead I speak from the heavens through visions to fellow umans to share reality of deadly viruses..

Expand full comment
Factscinator's avatar

LOL 😀😀 You have rescued me. I couldn't BEAR the thought of going without a viral teddy-tory tonight.

Expand full comment
Crixcyon's avatar

What the heck would scare the crap you of you more than some deadly virus that can't be seen and has no known antidote or there is no "vaccine" available to provide "protection"? It seems to be moving through space at a rapid pace. There are dead bodies everywhere. The hospitals and medical centers are bulging at the seams with infected patients.

The media has taken the new pandemic fear level to the pinnacle of what a nuclear war would be like. The medical "experts" are warning us that we need to take super extra precautions as science races to develop a "vaccine" that will save the planet from a horrible death. Even all governments are in on this. They appeared to actually care about us for a change.

We are then to believe our masters will save us slaves from the clutches of this evil virus. It's a novel virus they say, from the wild, uncontrollable and wickedly deadly and more sinister than its earlier cousin, CoV-1. They invent tests for it, and the PRC test becomes the bedrock of testing methods.

Nearly everyone tests positive, even those with absolutely no symptoms. Anyone questioning this new raging pandemic is termed a denier, a crackpot, or a conspiracy theorist. And now we know the rest of the story as it continues to unfold. The real threat of death comes from the mRNA poisons, not some silly computer algorithm pretending to be a deadly virus.

But for some of us, we never feared the pandemic reaper. Why? Some of us haven't had any vaccines in decades and never got very ill or diseased. We knew that we had stayed relatively healthy without big pharma drugs as our Gods. Thus there was no way some invented virus was gonna take us down. We now have yet again further proof that we do not need big pharma poisons, like vaccines and mRNA injections to live healthy and happy lives.

Too bad we are in the very small minority. Oh wait, as being a minority we should be able to have a special day on the calendar...no-vaxxer day works for me and in fact we'll take the whole month of June to celebrate the vaccine resistance.

Expand full comment
Marc Debolt's avatar

They will unfortunately never discuss these matters in good faith, because they care only for the superficial illusion of what they deceptively call "scientific consensus". What they are really after is blind faith and obedience. If they really were the purported bastion of openness and enlightenment, the situation would be completely different and "deniers" would not be denigrated at every turn. Their ideas would simply be tested and confirmed or refuted openly, as people wrongly assume things work.

The closest we get to that is a flimsy appearance of discourse riddled with bad actors. Just see the Kirsch v Kaufman "debate" for a great example of the fakery. You'll just never find major purveyors of officialdom that normies would accept debating deniers. Such open scientism!

Expand full comment
Norman James's avatar

Countering the Critics: A Defense of Dr. Thomas Cowan's Theories on EMF, Conductive Chemicals, and Human Health https://normanjames.substack.com/p/countering-the-critics-a-defense

Expand full comment
Proton Magic's avatar

Hi Norman, I saw the clips, I don't have time to go over each point but let me just bud in a little.

First I'd like to forget the debunker guy as he is generally mistaken on most (but not all) fronts and his attitude and virus pushing just made me want to puke. He actually detracts from listening to Tom's points, not all which are correct, sorry about this.

First it sounds like this was in 2020 and I can see Tom's understanding might not have been to where we are to today on it.

-Tom is correct that EMFs are bad for us so he is onto something, especially with cell phones and 5G, but I don't think his explanation of electrification of the world from the 20s and onward fits the timelines of the flus correctly and was nothing then like it is now, even the 40 years before Covid.

-1918 flu seems to have started from "meningitis" vaccines given by Dr. Fredrick Gates at Fort Riley in Kansas and others and to returning soldiers and others using masks and aspirin.

-When they said flu went to South Africa, why do we believe this hype? There is no flu virus and no way to test for a virus that does not exist. Could just be seasonal flu and colds the news hyped up, sound familiar? We don't need to care about human modes of transport in 1918, but it wasn't from EMFs. Did some US military who got the meningitis vaxes get sick there? Maybe.

-Well of course there is no transmission, but anyway, VIRUSES DO NOT EXIST PERIOD, so I think we all agree with that.

-Cell calls do not go around the world because it is bathed in EMF from 100k satts in space, it goes to the cell towers then thru sea-bed cables to wherever. Satts on balloons at high atmosphere altitudes yes, satts in space seems to be a story: you can see chemtrails substack on it.

-We have lived without pandemics for many decades since WWII was finished (all the flu pandemics were really just media hype) in spite of the world being more and more electrified and getting more aluminum in us so this doesn't fit well for Tom (though I do think Al from child vaxes causes problems even without EMFs).

- Here in Tokyo with the city floating in wires and packed trains with millions of persons on their phones though there are no pandemics and illnesses over the last decades are not high (I don't like the EMFs still the same). There were only 2500 flu deaths in 2020, add 1500 more from covid labeled and there were 4,000/126 mil people, that is not a pandemic.

-Flu is only in the winter so that doesn't fit with EMF illness which should be all the time.

-Since 2020 there are lots of vax deaths, and mixing vax with EMFs could cause a problem sure.

-Now 5G is another issue though. There are 2 large correlation studies of 5G rollout and illness in 2020, but it is not happening now. I suspect it will happen again and worse.

-5G IS NOT A ZERO SUM GAME. It can be set at 2-3 GHz and not cause overt illness, or at 60 GHz and wreak havoc. They only need to ramp it up in strategic locations to get what they want-total control of the population. They also want to cull many countries but not all and that means a mix of infertility, 5G, vaxes, and hospital protocols, chemtrails etc. They are not going to make 5G so obvious to have it ramped up everywhere at once. In 2020 I was not articulate on all of this so don't blame Tom fully in that vid, though he made a number of mistakes as I note and I'm still not sure how up on it he is as he doesn't get into it much on his Wed Webinars.

Expand full comment
Frances Leader's avatar

The flu and its varieties do coincide with changes in electrification.

Please see the chart at the end of this article:

https://francesleader.substack.com/p/there-is-no-virus-there-is-no-lab

Note especially the entry for Spanish Flu!

Expand full comment
Proton Magic's avatar

I am dead set against 5G and even 4G and WiFi, ear buds, blue tooth and smart watches and smart meters, do believe 5G caused illness in 2020, but I have trouble with that chart, although I can imagine localized flu-like cases around EMF hot spots. EMFs in big cities in the last 30 yrs are much greater than from 1917- 80s but there are no pandemics. H1N1 was hype. Here in Japan, the place has been teeming with EMF and phones in sardine packed trains for decades. There are no pandemics and flus are only in the winter.

This is my understanding of the Spanish flu, perhaps this paste-in is not complete:

A report from July 20, 1918, by Frederick L. Gates, M.D. First Lieutenant, Medical Corps of the US Army ‘Antimeningitis Vaccination and Observations on Agglutinins in the Blood of Chronic Meningococcus Carriers’ confirms the history of the experiments on American soldiers:

Following an outbreak of epidemic meningitis at Camp Funston, Kansas, in October and November, 1917, a series of antimeningitis vaccinations was undertaken at Fort Riley. As the experiments continued, Gates reported that the men started to experience flu-like symptoms: Comparing the early symptoms of bacterial meningitis and even bacterial pneumonia to the flu is the sole reason why the vaccine experiments at Fort Riley, Kansas have been ignored as the main cause of the Spanish Flu. In fact, an interesting article from the New Scientist published on August 4th, 2008 ‘Bacteria were the real killers in 1918 flu pandemic’ partially admits that “Medical and scientific experts now agree that bacteria, not influenza viruses, were the greatest cause of death during the 1918 flu pandemic.” The reason I say that the article “partially admits” is that it was bacteria and not the influenza virus that was the cause of death because the article never mentioned that it was the bacterial meningitis vaccine that spread the flu among soldiers and civilians. Bacterial pneumonia that came on the heels of mostly mild cases of flu killed the majority of the 20 to 100 million victims of the so-called Spanish flu.

Expand full comment
Frances Leader's avatar

Yes I have seen that narrative but it has to be noted that the vaccine programme was quickly introduced by the Rockefeller Institute to cover up the impact of high powered radio signals. This same successful obfuscation has been repeated during the Covid fiasco.

Nowadays people seem to have forgotten that people were getting very ill and dying before the vaccines were rolled out.

Therefore, it is very difficult to convince people that the sudden deaths and terrible disabling impacts we are now seeing could be attributed to the effects of cumulative electro-magnetic radiation.

I have never known a flu to cause hair loss, tooth loss, neuropathy strokes and myocarditis - have you?

Expand full comment
Proton Magic's avatar

Ok there may be hot spots I can agree. But here in Tokyo, as an example, the largest city on the planet with 33 mil people with high density of people and electric and cell tower grid, has not had any pandemic I can recall in decades though bathed in EMFs and 17 million people riding packed trains daily with nearly everyone on their phone. So wherever there were some illnesses it can not be the normal amount of EMF in a city. Could EMF cause autoimmune disease or cancer I can believe that, but those are not pandemic like illnesses and the discussion here (Tom's video) is about flu-like symptoms on a pandemic level. I personally NEVER get sick. People close to me, have a few days of a cold a couple times a year. They are bathed in Wifi daily, the whole frickin place here is but people look well-except for some obviously vaxed injured that didnt exist before '21. I think we should leave it at this, we are all against EMFs, if/how they cause pandemics is not clear.

Expand full comment
Frances Leader's avatar

EMFs do not cause pandemics. They cause a wide variety of illnesses which are different for each individual. They murder insects and birds wholesale. They cause blooms of parasites, moulds and yeasts. They are COVERED UP by declarations of 'pandemics' and contagion. They are not contagious. They are cumulative.

Obviously you did not closely examine the chart I recommended in my first comment here and frankly, I couldn't give a flying fluff what Tom Cowan says. I prefer to respect a real expert like Yuri Grigoriev.

https://francesleader.substack.com/p/the-cold-war-of-electro-magnetic

Expand full comment
Norman James's avatar

you will like this Frances https://normanjames.substack.com/p/kochs-postulates-bacterial-boundaries. Koch's Postulates: Bacterial Boundaries, Viral Visions - Unraveling Enigmas Beyond Classical Framework

Rethinking Viruses: Questioning Classical Paradigms

Expand full comment
James's avatar

Right you are. The virus and associated contagion narrative is just a cover story for the effects of the electrification of the world, and no one is getting in the way of the big boys progress $ even if it kills us.

Whenever there is a new power source/line and new man made EM Frequency implemented, there always follows a new major illness and so called pandemic.

Even before the electrification of our world, for instance, Influenza is a centuries old illness that's been well documented and recorded to affect populations in the worlds hemisphere always from East to West. We are electromagnet beings therefore affected by the electromagnetic world we are a part of. The suns solar energy is the life and death of this plane/t.

Essential reading: The Invisible Rainbow - A history of Electricity and Life

Expand full comment
Norman James's avatar

it does both it covers it up and makes it worse

Expand full comment
Frances Leader's avatar

The poison jabs OBVIOUSLY make matters worse. Any source of poison added to the assault would. That goes without saying. That is the whole point of introducing fake vaccines with any old floor sweepings added into the mix!

The vaccines take all the verbal flak. They prevent people from being able to pinpoint the REAL dangers of electrification and electro-magnetic radiation. They cause long drawn out idiotic conversations like this one because everyone is distracted from the ROOT CAUSE and ROOT WEAPON. I give up. Some people are just unable to see.

Expand full comment
James's avatar

The book "The Invisible rainbow - A history of electricity and life"

by: Arthur Firstenberg.

Is a must read for anyone looking for the pieces of the puzzle that ties all others together. You will be amazed at what this book covers.

Love your work PM

Thanks

Expand full comment
Proton Magic's avatar

Thanks Derek, I've read some of his posts, like them, until I saw him promote climate change....not knowing that is a farce and part of the world govt tip toe is incongruent with his research skills. Sorry to be honestly blunt...

Expand full comment
James's avatar

Sure, no ones perfect, but regarding the subject he focuses on, with an extensive bibliography of reference material dating back centuries, his book and knowledge on the subject in my opinion is solid.

Yes' agreed, climate change is total BS and a serves the long running agenda like viruses.

Expand full comment
Norman James's avatar

"Tom is correct that EMFs are bad for us so he is onto something, especially with cell phones and 5G, but I don't think his explanation of electrification of the world from the 20s and onward fits the timelines of the flu correctly and nothing then like it is now, even the 40 years before Covid" this is the adaptability of bacteria they have slowly began to communicate through the noise and quorum sensing and balance can be achieved somewhat.. If you look at my point in the article about the oboe system and meningitis . - Here in Tokyo with the city floating in wires and packed trains with millions of persons on their phones though there are no pandemics and illnesses over the last decades are not high (I don't like the EMFs still the same). There were only 2500 flu deaths in 2020, add 1500 more from COVID-19 labeled and there were 4,000/126 mil people, that is not a pandemic. Yeah, but the birth rate is dropping.. with EMF in different races it can be quite different. smaller people don't feel it as much African people Dr. Barrie Trower explains it makes them aggressive and naughty. In Japan it may lead to different effects. but Japan has a rather healthy diet strict regs with chemicals in food potentially the way the wiring is. do you have 800-900mhz there there is so many variables. the biggest is grounding I've noticed here in Thailand less disease as more grounding and sun. you may see it more in syndromes than cases of flu. and Flu is only in the winter so that doesn't fit with EMF illness which should be all the time....... this can be counterintuitive but what disappeared from the trees in winter leaves and those leaves were absorbing the RFR surrounding them and no there is no more surface area so less which = more RFR,,,,,,, Vax amd EMF 100% do the electric diet works 100% of the time to remediate symptoms and yea cowan I notice he was doing his bit but not being too controversial

Expand full comment
Proton Magic's avatar

Not sure I follow you completely, but there are many huge US military people here on many bases eating lots of bad stuff. I know the bases well, there have been no pandemics here in 40 years period. Japanese are also much taller and larger than they were 30 years ago.

Now I do not like EMFs of any kind and am dead against 5G and do think it contributed to illness in 2020 in Italy, NY and other strategic places, but 5G at who knows how many GHz is not the same and electrification from 1917 and there are zero pandemics here and elsewhere even in the last 30 years. EMF may cause many problems but they did not cause pandemics on any apparent basis in the last 40 years. H1N1 was media hype. Anyway Tom is on track about 5G but his ideas of EMFs and what they have done isn't fitting well, see my reply to Frances Leader in this thread. Tom made multiple mistakes but the debunker guy should be put on a rocket and sent far away.

Expand full comment
Norman James's avatar

Is the size from swelling? Your first clue is weight gain. I've watched Thailand go back and forth since 2002, from being skinny to the second fattest country in Asia. When I saw this stark comparison, I looked at old photos of us as kids, and we were so skinny compared to these kids. Even people that don't eat a lot put on weight. Well, I believe these toxins are near the skin in the fat, as your bacteria have placed them safely away, ready for removal when you are safe from EMF so they can communicate again.

I've just done this 3 times in 7 years, moving from home to home, dropping the first time over 25kg in weight and the second time another 10kg in a Faraday net. EMF increased weight increased 27kg. Now I'm doing the same thing again in an EMF-free environment. As soon as I was only eating meat, my body kicked into ketosis automatically. Fasting, sleeping with no aircon, my sweat is dirty. Hormone issues are related to gut biome, which is food and EMF (https://normanjames.substack.com/p/the-hidden-link-between-emf-gut-bacteria). FAST of probiotics, fast, kefir, cheese, kombucha, ginger bug, mead, beer, and a glass of wine before bed. I've dropped 12 kg and put on a lot of muscle from memory from training previously in 2 months. My wife didn't believe me when I said when my bacteria is safe, I'll be able to control my drinking and eating, and they did just that with ease.

For perspective, I am a self-taught building biologist, plus Geovital assessment, and I have built rest homes and worked in all aspects of them. I'm also a botanist, and environments, especially aquaponics, have given me a deep understanding of bacteria and environments. It's given me a good grounding to start. I have found it very interesting how and why people get sick in their homes.

In Spain, I noticed that the walls in the home that contain the main power lines are in one place, and from there, they are placed all around the concrete homes with tiled floors so the EMF was minimal. In the UK, there are large amounts of cables put under floorboards, a lot of them, where we sleep, are coated in foil making unearthed faraday cages, and I think Britain, and small country, is very affected. Here in Thailand, with metal roofs, the incident I have had to remove my family's past EMF problems with this home. I explain in one of my blogs. https://normanjames.substack.com/p/the-invisible-influence-how-a-painted

Poland apparently has very strict rules with wiring and home building compared to the UK. In Germany, they have on-demand switches and strict laws on EMF on buildings, especially in cities. There are more toxic problems also, like I noticed the pipes are PVC left in the sun with no protection, leaching monomers which react with EMF and cause hormone imbalances. The receipts and BPA also react to EMF (https://normanjames.substack.com/p/thermal-receipts-pose-a-hidden-danger).

My point is I would have to assess the environment. When you look at the army who have to train and eat shit, you will find that sweating is one of the biggest influencers in the flu. Take Sweden, for example, with their culture of saunas, and then hotter countries where sweating is normal and where people are more grounded. In America, they eat chemicals and sleep in homes with smart meters. It may be the mountains in Japan and the geobiology of the place that protects it, like what the pyramids were for Electroculture PLANT POWER (https://normanjames.substack.com/p/pyramids-logical-reasoning?utm_source=publication-search). I mean, look at the beauty of the plants and trees in Japan. Maybe it has a natural extension of the Earth's magnetic field that negates many effects. The world and ourselves work on the Pareto principle as well as balance and there are bound to be countries that are affected by EMF on a similar scale.

Expand full comment
Proton Magic's avatar

No, most Japanese are not fat. They are normally proportioned, most men are 5'8' to 6'0", and women 5'3" to 5'10", there is no reason for them not to get EMF illness based on body size.

Expand full comment
Norman James's avatar

so there is something that negates it. Buildings are the main reason for most illness today

Expand full comment
James's avatar

Excellent. Yes obesity epidemic' Also a lack of vitamin(D) could trigger the body to go into storage mode to bulk up for the winter months, when traditionally there may be a scarcity of food. We know the environment is being altered/sprayed, and also we're spending more time indoors indoors. Oh the fast/fake food epidemic cant be overlook also.

Expand full comment
Norman James's avatar

that's a huge point. sunbeds always used to make me feel better in winter. watch this https://www.youtube.com/channel/UCwTTz_rr27s1lITSBiqQWzA

Expand full comment
Norman James's avatar

Seasonal depression disorder is from maninly the amounts of EMF increasing in winter.

Foliage: As you mentioned, in summer, trees have full leaves which can absorb or scatter some of the radio frequency (RF) signals from cell towers. Leaves contain water which can attenuate signals to some degree. In winter, without leaves, there may be slightly less obstruction. However, the impact is usually minor, especially for modern cell networks.

Atmospheric conditions: Factors like temperature, humidity and air density can impact how RF signals travel through the air. In general, cooler temperatures and lower humidity (as seen in winter in many areas) allow signals to propagate slightly better than hot, humid summer conditions. But again, the effect is relatively minor.

just to point out it is not minor as RFR never disappears it is neverending unless absorbed and it could take 10-20 years for the earth to absorb it if we turned it off today. We are unable to detect it. but our bacteria can also be confused you use more energy in winter which amplifies the effect as near an electric field RFR effects increase exponentially

Expand full comment
Proton Magic's avatar

There is little foliage around most folks in Tokyo, it is 33 mil people IN ONE METRO AREA they do not have pandemics. We are getting silly now.

Expand full comment
Norman James's avatar

were not actually we are getting somewhere pointing out where it is not the problem. environments are complex crowded unsanitary conditions + emf increasing bacteria clean city of Tokyo until migration takes over. it might be the cleanliness. it might be a safer mobile phone network with frequencies that are better/ the mountain increasing the magnetic field from the earth goes with geovitals undertanding of how EMF can affect you more with curry and Hartmann lines blocking the magnetic field in your home

Expand full comment
Norman James's avatar

so also i used to find it odd watching those people who go around cleaning bathrooms for fun in Japan probably the cleanest country in the wold. Perspective

People can get Legionnaires' disease by inhaling water droplets that contain the bacteria. The bacteria can also enter the body through cuts or scrapes in the skin.

The symptoms of Legionnaires' disease typically start 2-10 days after exposure to the bacteria and include fever, cough, shortness of breath, muscle aches, and headache. In severe cases, the disease can lead to respiratory failure and death.

The perfect environment for Legionella bacteria is warm, stagnant water. The bacteria can grow in a variety of environments, including:

Hot tubs

Cooling towers

Air conditioners

Fountains

Hot water tanks

Humidifiers

Spa pools

Large water systems, such as those in hospitals and hotels

All these use electricity!

Hot tubs and spa pools can create warm, stagnant water without the use of electricity. However, they may have an electric field present. This is because they often have pumps and other electrical components that can create an electric field.

The electric field may not be strong enough to kill Legionella bacteria, but it could potentially help the GN bacteria to grow. This is because the electric field could disrupt the biofilm that the bacteria form.

They also need However, it is important to note that electricity is not the only factor

The other important factors include:

Warm water (between 20 and 45 degrees Celsius)

Stagnant water

Turbid water (water that is cloudy or murky)

Water that contains organic matter

Water that is low in chlorine

Some examples AI pointed me to.

A woman in the United Kingdom reported that she developed Legionnaires' disease after staying in a hotel room that was located near a substation.

A man in the United States reported that he developed Legionnaires' disease after working in a factory that used electric motors.

A woman in Australia reported that she developed Legionnaires' disease after living in a house that was located near a power line.

A man in Canada reported that he developed Legionnaires' disease after staying in a hotel room that was located near a radio tower.

A woman in France reported that she developed Legionnaires' disease after working in a factory that used electric welding equipment.

A man in Germany reported that he developed Legionnaires' disease after living in a house that was located near a power substation.

Exposure to radiofrequency radiation can have a significant impact on the growth and antibiotic resistance of Klebsiella pneumoniae. Further research is needed to confirm these findings and to determine the mechanisms by which radiofrequency radiation exerts its effects on this bacterium.

Expand full comment
Norman James's avatar

Yes, that man is a clown. the other thing to note i that japenese people eat Natto Nattokinase Nattokinase-fermented foods in many cultures have stopped this and its detrimental to humans especially with EMF wrecking the biome which is your immune system

Expand full comment
Proton Magic's avatar

Most Japanese do not eat this so frequently. That is not enough of a reason.

Expand full comment
Norman James's avatar

you wouldn't have to eat this every day once a week or even month may be enough as you have fed your biome which populates

Expand full comment
Norman James's avatar

1 of many. i thought it was consumed often it helps stops eczema in Japanese people

Expand full comment
Norman James's avatar

about pneumonia and EMF i also go into aids and related breast implant illness nested in here https://normanjames.substack.com/p/can-wi-fi-exposure-increase-susceptibility?utm_source=publication-search

Expand full comment
Norman James's avatar

Fauci said it was pneumonia the Spanish flu and you mentioned meningitis Oboe an 800-900 mhz https://normanjames.substack.com/p/potential-effects-of-high-power-radio?utm_source=publication-search. and the meningitis vaccine https://normanjames.substack.com/p/the-1990s-meningitis-outbreak-in

Expand full comment
James's avatar

Great work Norman, but consider that all the figures we get, on anything is from the same system that can't be trusted, so how can we rely on any so called facts or figures presented ?

Expand full comment
Norman James's avatar

Thank you pass it on and way ahead of you. I ask questions on Facebook groups and get live answers like Amazon reviews and they are really trustworthy.... this will help you be > 80% more accurate https://normanjames.substack.com/p/logic-wisdom-then-science-to-confirm?utm_source=publication-search

Expand full comment
James's avatar

Historical accounts point to many of the new illnesses/pandemics which coincide with the path of the worlds electrification, like telegraph, and AC power lines, also military being those at the forefront of wireless technology, radio comms, radar etc, with the general population at at distance also being subjected to these technologies. Who was using microwave/radar tech first 'military of course', and wasn't until they realised people were being affected/cooked, that a commercial use was engineered, being the microwave oven. 2.45Ghz, though lower power includes WIFI and BTooth.

Expand full comment
Factscinator's avatar

GREAT CLIP!! CHEERS đŸ»

Expand full comment
Norman James's avatar

no worries pass it on .

Expand full comment
Factscinator's avatar

Will do. Tom speaks soooo much sense!!

Expand full comment
I woke up to this's avatar

As far as I'm concerned, CV-19 was the flu or poisoning.

But would someone explain Chicken Pox to me? Terrain theory never quite answered this for me, but it's all over my head anyway. Thanks!

Expand full comment
Proton Magic's avatar

Hi, there is no such thing as a flu virus or C-19 virus. At the bottom of this post here you can find the causes of illness in 2020

https://protonmagic.substack.com/p/the-most-entertaining-government

On CP,

https://viroliegy.com/?s=chicken+pox

Expand full comment
GeoffPainPhD's avatar

You will absolutely love the history of Pfizer mass producing Viruses for the US Offensive BioWeapons effort.

Pfizer mass produced Mason-Pfizer Monkey Virus, Feline Leukemia Virus, RD-114 Virus and Epstein-Barr Virus for US government "Cancer" Research

https://geoffpain.substack.com/p/pfizer-contracted-for-mass-production

Expand full comment
Proton Magic's avatar

Welcome Geoff, you give us fun stuff to study.

The monkey pox virus you quote in your SS is from this paper

https://aacrjournals.org/cancerres/article/30/8/2081/478176/A-New-Virus-in-a-Spontaneous-Mammary-Tumor-of-a

Click the PDF to read. At no place was a virus isolated, purified, or characterized. They looked at slices of mixed tumor cancer, and saw shadows of what was in there after it was fixed and bombarded by electrons:

"Electron microscopy of many thin sections of the monkey mammary carcinoma revealed the presence of a large number of virus particles in the intercellular spaces of the epithelial

cells."

👉They saw dots on EM photo, that is not isolation or characterization of anything. There is no way to know what those are.

👉the initial fake “discovery” of monkey pox in 1958 had not found any virus, only cell fragments in a toxic mixed cell culture with no purified isolate, no pathogen confirmed, and no blind control. HERE: https://doi.org/10.1111/j.1699-0463.1959.tb00328.x

👉Monkey pox is autoimmune inflammation aka Steven’s Johnson Syndrome due to jabs. There are no pox viruses period (www.theviraldelusion.com vid 2).

Expand full comment
Charlie's avatar

Note the time. 3:33. See the truth positive, even the numbers speak truth.

Gosh golly, amazing!

Expand full comment